Transcribe and translate the following DNA sequence (don't forget about START and STOP codons):ACGGTACCCCGGGACTGACTTGCA aMet - Ser - Gly bMet - Pro - Gly cThr - Gly - Ser dCys - His - Gly - Ala - Leu - Thr - Glu - Arg eLeu - Thr - Glu - Arg fMet - Gly - Pro gCys - His - Gly - Ala - Leu hThr - Ser - Gly

Question 3How many DNA strings transcribe and translate into the amino acid string LEADER?

The sequence of codons on the DNA is read in only one way between start and stop codons, called the ______________________. A. Degeneratiewe kode / degenerate code B. Wobble hipotese / wobble hypothesis C. Nie een van bogenoemde nie / None of the above D. leesraam / reading frame

The base sequences of a short section of DNA are shown, together with mRNA that has beentranscribed from it and one of the tRNA anticodons that could be used to translate the mRNA.DNA strand 1 A-C-G-G-C-A-T-T-A-G-C-T-A tRNA anticodon U-U-ADNA strand 2 T-G-C-C-G-T-A-A-T-C-G-A-T mRNA U-G-C-C-G-U-A-A-U-C-G-A-UWhich strand of DNA is transcribed and to which codon in the mRNA would the tRNA anticodonbind during translation?DNA strand transcribed mRNA codon thattRNA anticodon binds toA. DNA strand 1 secondB. DNA strand 2 secondC. DNA strand 1 thirdD. DNA strand 2 third

In the sequence "GCCGCCRCCAUGG," the "R" representsGroup of answer choicesany baseany nucleotidea purineargininea stop codon

Write the protein sequence in one-letter code that would be synthesized. (1 mark)      5’-ATGGCTGGGTGCTTTTAA-3’