ou add 100 copies of a target gene to a thermocycler and set it to run through 30 cycles. How many copies can you expect once the procedure is finished?ANSWERAbout 1x109About 1x108About 1x1011About 1x1010

You are programming a thermocycler and are setting temperature of the second step in your protocol to 62°C. What is happening during this step?ANSWERIt separates double-stranded DNA into single strands that can be copied.It allows the primers to anneal.Nothing is happening at this temperature, as DNA replication is halted.The temperature allows DNA polymerase to copy the target DNA.

The number of molecules of DNA in a cell in the G1 stage of the cell cycle is 20. The expected number of molecules in the same cell in the G2 stage of the cell cycle would be

Darshan wants to set up a PCR reaction for his gene of interest. The sequence of the DNA strand is as follows: Template strand: 5’ ACTGCGTATGCCGATCGTATGCCGTATGC 3’ What should be the annealing temperature should he set in the thermal cycler for successful conduct of the experiments? [Hint: The forward primer consists of 14 bases] 44°C 72°C 94°C 56 °C

the DNA is replicated

Organize the following steps of a PCR cycle in the correct sequence.The mixture is cooled to allow the binding of primers to the end of target DNA sequences.Free nucleotides are added in the 5’ to 3’ direction by the Taq DNA polymerase.The reaction mixture is heated to separate the double-stranded DNA.Group of answer choices1, 2, 31, 3, 22, 1, 32, 3, 13, 1, 23, 2, 1