You are programming a thermocycler and are setting temperature of the second step in your protocol to 62°C. What is happening during this step?ANSWERIt separates double-stranded DNA into single strands that can be copied.It allows the primers to anneal.Nothing is happening at this temperature, as DNA replication is halted.The temperature allows DNA polymerase to copy the target DNA.

The purpose of the step at 72°C is A. binding of DNA polymerase to the DNA B. binding of the primers to single stranded DNA C. denaturation of DNA D. Synthesis of a complementary stra

Darshan wants to set up a PCR reaction for his gene of interest. The sequence of the DNA strand is as follows: Template strand: 5’ ACTGCGTATGCCGATCGTATGCCGTATGC 3’ What should be the annealing temperature should he set in the thermal cycler for successful conduct of the experiments? [Hint: The forward primer consists of 14 bases] 44°C 72°C 94°C 56 °C

The PCR reaction is based on A. DNA replication B. Temperature cycles C. Copies of a target DNA sequence D. All the options

ou add 100 copies of a target gene to a thermocycler and set it to run through 30 cycles. How many copies can you expect once the procedure is finished?ANSWERAbout 1x109About 1x108About 1x1011About 1x1010

Explain with neat schematic Low temperature control in VCRcycle.