AAACTTGAATAAACGTAACGACGGTTGCTAACGCGTTAGTGCCGCGCCCTCAGCTATAATGACATGStep 1: TranscriptionIf this segment of DNA is used to build a strand of messenger RNA, what will be the sequence of the nucleotides? Use Watson-Crick base pair rules to arrive at your answer.
Question
AAACTTGAATAAACGTAACGACGGTTGCTAACGCGTTAGTGCCGCGCCCTCAGCTATAATGACATGStep 1: TranscriptionIf this segment of DNA is used to build a strand of messenger RNA, what will be the sequence of the nucleotides? Use Watson-Crick base pair rules to arrive at your answer.
Solution
The process of transcription involves the synthesis of messenger RNA (mRNA) from a DNA template. According to the Watson-Crick base pairing rules, Adenine (A) pairs with Thymine (T) and Cytosine (C) pairs with Guanine (G). However, in RNA, Thymine is replaced by Uracil (U).
So, the DNA sequence "AAACTTGAATAAACGTAACGACGGTTGCTAACGCGTTAGTGCCGCGCCCTCAGCTATAATGACATG" would transcribe to the following mRNA sequence:
"UUUGAACUUAUUUCAUUUGCUUGCCCAACGAUUGCGCAAUCACGGCGCGGGAUCGCGAUUAUACUGUAC"
Similar Questions
Question 1Feliciaand Cait have encoded a message for you using DNA. You will need to use what you’velearned about transcription and translation in order to decode the message contained in this segment of DNA.AAACTTGAATAAACGTAACGACGGTTGCTAACGCGTTAGTGCCGCGCCCTCAGCTATAATGACATGStep 1: TranscriptionIf this segment of DNA is used to build a strand of messenger RNA, what will be the sequence of the nucleotides? Use Watson-Crick base pair rules to arrive at your answer.0 / 5 pointsUUUGAACUUAUUUGCAUUGCUGCCAACGAUUGCGCAAUCACGGCGCGGGAUCGAUAUUACUGUACIncorrect2.Question 2Step 2: TranslationTranslate the message contained in the RNA (your answer from Step 1) into the code to build a protein. Use the codon wheel below to translate your answer to Step 1 into a sequence of amino acids. Find the first letter of your sequence in the inner circle and work outwards to find the letter representing the corresponding amino acid. For example, the codon ATG = M (methionine). In your answer, each amino acid will be represented by a single lette
If the sequence of bases in the template strand of a DNA molecule is 3' ATCGCTCC 5', what is the sequence of bases in the RNA that is transcribed from this molecule?Multiple Choice5' AUCGCUCC 3'3' UAGCGAGG 5'3' TAGCGAGG 5'5' UAGCGAGG 3'5' TAGCGAGG 3'
If the nontemplate strand of a gene in E. coli had the sequence: 5 ′ -TTGACA-(18 bases)-TATAAT-(8 bases)-GCCTTCCAGTG-3 ′ what nucleotide sequence would be present in the RNA transcript of this gene?
The diagram shows a sequence of bases on a DNA template: CAC GTT CGC ATA GAC Which one of the following shows the sequence of bases on the complementary mRNA strand with one substitution mutation? A) CUC GTT CGC UTT GUC B) GTG CAA GGG TAT CTG C) GUG CAA CCG UAU CUG D) GUG CAA GCG UAU GUC E) GTG CAA GCG TAT CTG
Making a messenger RNA using DNA as a template is called __________________.
Upgrade your grade with Knowee
Get personalized homework help. Review tough concepts in more detail, or go deeper into your topic by exploring other relevant questions.