Knowee
Questions
Features
Study Tools

WAP that will print the complement DNA sequence of your choice

Question

WAP that will print the complement DNA sequence of your choice

🧐 Not the exact question you are looking for?Go ask a question

Solution

Sure, here is a simple Python program that will print the complement DNA sequence of your choice:

def complement_dna(dna_sequence):
    complement = {'A': 'T', 'C': 'G', 'G': 'C', 'T': 'A'} 
    return "".join(complement[base] for base in dna_sequence)

dna_sequence = "ATGC" # You can replace this with the

Similar Questions

WAP that will translate a DNA sequence into protein

Write the sequence of nucleotides that should be put in the five blank spaces, in order to make the DNA complement of the sequence TACGT.

Transcribe and translate the following DNA sequence (don't forget about START and STOP codons):ACGGTACCCCGGGACTGACTTGCA aMet - Ser - Gly bMet - Pro - Gly cThr - Gly - Ser dCys - His - Gly - Ala - Leu - Thr - Glu - Arg eLeu - Thr - Glu - Arg fMet - Gly - Pro gCys - His - Gly - Ala - Leu hThr - Ser - Gly

5’- ACAGTCCTTAAGCAAGATAGGTCTAAGATTGCAG-3’ What would be the m-RNA sequence that is complementary to above sequence?

The sequence of codons on the DNA is read in only one way between start and stop codons, called the ______________________. A. Degeneratiewe kode / degenerate code B. Wobble hipotese / wobble hypothesis C. Nie een van bogenoemde nie / None of the above D. leesraam / reading frame

1/1

Upgrade your grade with Knowee

Get personalized homework help. Review tough concepts in more detail, or go deeper into your topic by exploring other relevant questions.